-
Essay / Zebrafish and human diseases - 1477
1.0 Introduction1.1 ZebrafishZebrafish are commonly used for studies involving human diseases. (7). Zebrafish have a very common genome compared to humans and are an excellent research tool for many human diseases. 300 million years separate zebrafish from the last known common ancestor of humans. Surprisingly, their genome remains a valuable resource for research into cancer and many other genetic diseases due to their vast genomic similarities (1). Zebrafish is a model organism in many studies of diseases such as cancer, human genetic diseases, neurological diseases, Alzheimer's disease and many others (8).1.2 Polymerase chain reaction (PCR ) and RT-PCRThe polymerase chain reaction (PCR) is used to isolate a predetermined strand of DNA on the double helix. Once the desired DNA is isolated, it can be copied as much as necessary (2). In this experiment, PCR was used to isolate Vangl2 from zebrafish embryos. In a PCR experiment, a primer is used to find and isolate the desired nucleotide sequence from DNA (2). In this experiment, two primers were used as follows: 5' GTGCATGTCTTCACCATTGA 3' 5' CACATTGTTAGAAGCGGCTGG 3'5' CACCACTTGAATGCAGATAGGA 3' 5' GTCCACATTGTAGGAGCGGGG3' Also in a PRC reaction, the DNA polymerase is made up of many complicated proteins with the function to duplicate DNA before division occurs (2). Reverse transcriptase polymerase chain reaction (RT-PCR) is a frequently used method to observe RNA expression levels (10). Using RT-PCR, it is possible to identify a predetermined gene (vangl2) via complementary deoxyribonucleic acid (cDNA) (9). RT-PCR can then be used to clone the targeted gene by reverse transcription of its cDNA via the enzyme reverse transcriptase (10).1.3 Gel electrophoresis.F...... middle of article.... ..udhry B., Copp AJ, Henderson DJ (2005) “Vangl2 acts via RhoA signaling to regulate polarized cell movements during proximal outflow tract development, nd Web. March 11, 20146. Borovina, Superina, Voskas, Cirunia. (2010) “Vangl2 directs the posterior tilt and asymmetric localization of mobile primary cilia, nd Web. 15 March 20147. Ingham P. (2009) “The power of zebrafish for disease analysis, nd Web. March 15, 20148. Wen Z. (2013) “The zebrafish model: use in the study of cellular mechanisms for a spectrum of clinical disease entities, nd Web. March 15, 20149. Bustin SA, Benes V, Nolan T, Pfaffl MW (June 2005). "Quantitative real-time RT-PCR – a perspective". J. Mol. Endocrinol. Mon. April 21, 201410. Bustin SA (October 2000). "Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays". J..